Sequences from confirmation amplicon


Confirmation sequences for line 148A10 and hit At5g18240 are shown.
Line ID 148A10
Locus At5g18240 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:6028835
Primers used for PCR BA39 - 8474, show primer details
   
Sequence Name 57-K105015-0022-148-A10C-BA39
GenBank Accession LN509412 [GenBank]
Sequencing primer gene specific primer, BA39: 5'-CAAGCTAACAAAGGAAATCAAAGG-3'
Sequence (A. th genome BLAST matches underlined)
>57-K105015-0022-148-A10C-BA39
TTGTTGCACTCTTCTAAGCTTATTTGTTCTTCTCAATTCCAGCTGAAACCATTTAAATCA
AACTGTTTAGGACGCGTTGTGCCATAGTTTTCGTCGTGTGTGTTAAGATCTAGAGCTGTT
CTTGTGTGTGTTTCAAGCTTGCAATCTTCATTATTCTCGTTGAATCTTTCTTCTGTATAC
TCACTGTTGTTGCTACTCCTTCCTCTGTGTTCATGTAATCCCACTCCTATTGACAATCTT
CCAGGACTTCTACATGTCCTGGAAATCTACATGTACAGGATATATTCAATTGTAAATGGC
TTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAA
GAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
   
Sequence Name 41-K105016-0022-148-A10C-8409
GenBank Accession LN504074 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K105016-0022-148-A10C-8409
TTGAATAATCCTGTACATGTAGATTTCCAGGACATGTAGAAGTCCTGGAAGATTGTCAAT
AGGAGTGGGATTACATGAACACAGAGGAAGGAGTAGCAACAACAGTGAGTATACAGAAGA
AAGATTCAACGAGAATAATGAAGATTGCAAGCTTGAAACACACACAAGAACAGCTCTAGA
TCTTAACACACACGACGAAAACTATGGCACAACGCGTCCTAAACAGTTTGATTTAAATGG
TTTCAGCTGGAATTGAGAAGAACAAATAAGCTTTAGAAGAGTGCAACAACCTTTTTATGA
TAATCACACAGGAAATGAAAAGCCTTTGATTTCCTTGTTTAGCTT

Last Updated on 07.07.2016 14:16