SimpleSearch - Line and FST details


Line specific information

 
Line ID 026F09
Vector Used pAC106
Line Availability available as T3 set from NASC (N402469)
Segregation Analysis 50:22:14
Confirmed for Hit At1g34340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g34340

 
Sequence (A. th genome BLAST matches underlined) 
>026F09-LB-1-12533962-R-150-a
TTTACTTGGGATGCTCCTAAACTACATCTTCCGTAAGAAGCAACGACCCACAACAACATC
CACATCCTGAAGTTGCTTTCTTTCTCAACATCTCCATTCACTCATTCTTCTATCTGTTAA
CCTATTATCGATTATTGAGAATGTTAATAA
GenBank Accession KG780225 [GenBank]
Graphic View Graphic view of gene At1g34340
Predicted Position of Insertion Chr1:12533962 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F23M19
Hit Gene Code At1g34340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG780225 [GenBank] KG780225 [GenBank]


Last Updated on 10.06.2021 13:37