SimpleSearch - Line and FST details
Line specific information
Line ID | 426C02 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N440826) |
Segregation Analysis | 50:34:31 |
Confirmed for Hit | At1g63140 |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At1g63140
Sequence (A. th genome BLAST matches underlined) | >11-K018075-022-426-C02-8409 TAATATCATGTCTTTGAGATGTTCCCTATGGGATCCTCCCCTATAGTGAG |
GenBank Accession | BX289417 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr1:23418260 - go to primer design |
BLAST e Value | 1e-06 |
Hit Clone Code (BAC ID) | F16M19 |
Hit Gene Code | At1g63140 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | O-methyltransferase family protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on 10.06.2021 13:37 |