SimpleSearch - Line and FST details
Line specific information
| Line ID | 426C02 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N440826) |
| Segregation Analysis | 50:34:31 |
| Confirmed for Hit | At1g63140 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At1g63140
| Sequence (A. th genome BLAST matches underlined) | >11-K018075-022-426-C02-8409 TAATATCATGTCTTTGAGATGTTCCCTATGGGATCCTCCCCTATAGTGAG |
| GenBank Accession | BX289417 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr1:23418260 - go to primer design |
| BLAST e Value | 1e-06 |
| Hit Clone Code (BAC ID) | F16M19 |
| Hit Gene Code | At1g63140 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | O-methyltransferase family protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
