SimpleSearch - Line and FST details


Line specific information

 
Line ID 355F04
Vector Used pAC161
Line Availability available as T3 set from NASC (N434048)
Segregation Analysis 50:49:49
Confirmed for Hit At3g16320
Parent of DUPLO pair 2573
Parent of pair(s) none

Gene hit At3g16320

 
Sequence (A. th genome BLAST matches underlined)
>30-K016831-022-355-F04-8409
CGGACATTGAAGCCATTTTAAACTGGATATATACTCATATGTGAATCTCTCTGAAACATT
GTATGAGAGCAGTATCATGATCCTTACGCAAACTGGAACAGTTCCCATAGCTGCACACCT
GCAATTCATATTGCGACCACAGTCATTACAGAAAAAAATACAAGCAAAGAGAAAAGTCTG
CAGTTTCAGATTTTGATATGCTATGGGAT
GenBank Accession BX001381 [GenBank]
Graphic View Graphic view of gene At3g16320
Predicted Position of Insertion Chr3:5533370 - go to primer design
BLAST e Value 1e-50
Hit Clone Code (BAC ID) MYA6
Hit Gene Code At3g16320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 355F04 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37