SimpleSearch - Line and FST details


Line specific information

 
Line ID 552A03
Vector Used pAC161
Line Availability available as T3 set from NASC (N452899)
Segregation Analysis 60:46:43
Confirmed for Hit At5g08460 At1g29730
Parent of DUPLO pair none
Parent of pair(s) 86422, 86424

Gene hit At5g08460

 
Sequence (A. th genome BLAST matches underlined)
>17-K020588-022-552-A03-8409
CATTTACATTGATTTCCCGGTGAATGTGTCCAGGCTGTAACGAGATGGATGAACTTTTCA
CAACCGTCTTGTATCGCTGGCGGATCGTCTCAATTCCGATAACTAAACCGCTGTGGGATC
CTCCCTATAGTGAGGCCCTCTCGCGATTCCCAAGCATATTTTGTGTCTTGTTCCCCATTC
TATGGGATCCTCCCTATAGTGAGAACA
GenBank Accession BX572467 [GenBank]
Graphic View Graphic view of gene At5g08460
Predicted Position of Insertion Chr5:2734842 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) F8L15
Hit Gene Code At5g08460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDSL-like Lipase/Acylhydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 552A03 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37