SimpleSearch - Line and FST details


Line specific information

 
Line ID 830D10
Vector Used pAC106
Line Availability available as T3 set from NASC (N479630)
Segregation Analysis 50:17:11
Confirmed for Hit At5g38565
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g38565

 
Sequence (A. th genome BLAST matches underlined) 
>76-K025706-022-830-D10-8409
AATAGTGAACTCTTTAACATCTTGATGCACAGAACATATCACCGATAGATCATCAAGAAC
AGGACAAATAGATAGAATGTCCTGAAGAGATTTTCCTTCTACAAATGTCACACTGTCAAG
TTGCAAAGTTTTCAGAGAGGGAAAAGAAACAGTAGAGGGAACATCAATGAGAACCACGTT
GTCGAGTTTCAAGGTGACGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR400075 [GenBank]
Graphic View Graphic view of gene At5g38565
Predicted Position of Insertion Chr5:15445402 - go to primer design
BLAST e Value 5e-110
Hit Clone Code (BAC ID) MBB18
Hit Gene Code At5g38565 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/FBD-like domains containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR400075 [GenBank]


Last Updated on 10.06.2021 13:37