SimpleSearch - Line and FST details


Line specific information

 
Line ID 014H04
Vector Used pAC106
Line Availability available as T3 set from NASC (N401336)
Segregation Analysis 50:50:37
Confirmed for Hit At1g10230 At1g66130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g66130

 
Sequence (A. th genome BLAST matches underlined)
>32-K012792-022-014-H04-35St
CGTTTNCCGCCTTCGGTTTCCTCTATGGGGGGNGCACGATNCTTTGCTGTTGTTTGNTTG
GTTCCGCGGTGGCGCTCTGGCTTTTTATTCAAATTGCAAAA
GenBank Accession FR800390 [GenBank]
Graphic View Graphic view of gene At1g66130
Predicted Position of Insertion Chr1:24615458 - go to primer design
BLAST e Value 3e-05
Hit Clone Code (BAC ID) F15E12
Hit Gene Code At1g66130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 014H04 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37