SimpleSearch - Line and FST details


Line specific information

 
Line ID 052H09
Vector Used pAC161
Line Availability available as T3 set from NASC (N404989)
Segregation Analysis 50:49:48
Confirmed for Hit At3g50320
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02680

 
Sequence (A. th genome BLAST matches underlined)
>72-K104554-0022-052-H09-8409
TTAAGAAAAAGAGGAAGAACATTTGTATAAATTTGTCCAAAGTGACAATTTTGGCTCAGG
GGTAGGGTCCCCCCAGCCCCGAATTGTAACCCTTGGGGGGCCCCCCCAAAGTGGGGGTCA
TATACCTCTCGGGCTGATTGAGGGTTTTCACCTCACTGGTGCTTTCTTCCTTGTCTCGCT
GGTTTAAAGATTCTTACTTTTTGATGTCTAAGACATCTTAGATTTGTTAGACTCTCTTTG
G
GenBank Accession FR801589 [GenBank]
Graphic View Graphic view of gene At4g02680
Predicted Position of Insertion Chr4:1184987 - go to primer design
BLAST e Value 6e-42
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ETO1-like 1
Insertion Classification TS2TE (5')
Confirmation Status unknown
Other FSTs Supporting this Hit FR801590 [GenBank] AL753917 [GenBank] AL753916 [GenBank] FR801589 [GenBank]

 
Line 052H09 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37