SimpleSearch - Line and FST details


Line specific information

 
Line ID 059F02
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15K9

 
Sequence (A. th genome BLAST matches underlined) 
>059F02-LB-1-786009-R-150-a
TGTTTTTCACCTTTATATCCATTTATTAATGCGACCCCAAAATCAGTGCTCCGTGTAAAT
GTATTTGTCAGTTTATTCACATGATATTACCCCTTCTACACCAATCAATAAAATATACTA
CCGCTTTATCTTTAAGTATCTTAAATAATG
GenBank Accession KG780641 [GenBank]
Graphic View Graphic view of sequence KG780641 of line 059F02
Predicted Position of Insertion Chr1:786009 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F15K9
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit KG780641 [GenBank]


Last Updated on 10.06.2021 13:37