SimpleSearch - Line and FST details


Line specific information

 
Line ID 118G10
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18960

 
Sequence (A. th genome BLAST matches underlined)
>34-K028181-022-118-G10t-8409
ATTTGTTAGATAATTATGTGGTGAACGTTGATTTTGACACTTGACAAAAGTTTTGTATGG
GACCCTCCCTATAGTGAGTCCTATTACTCACTCTCTTT
GenBank Accession FR803398 [GenBank]
Graphic View Graphic view of gene At4g18960
Predicted Position of Insertion Chr4:10382977 - go to primer design
BLAST e Value 4e-15
Hit Clone Code (BAC ID) F13C5
Hit Gene Code At4g18960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 10.06.2021 13:37