SimpleSearch - Line and FST details


Line specific information

 
Line ID 164A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N415657)
Segregation Analysis 50:50:41
Confirmed for Hit At1g56570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g56570

 
Sequence (A. th genome BLAST matches underlined)
>65-K013275-022-164-A09-8409
TGGGTCCTAAAAGGATCACTACAAAAATACGGGGCCTCTGGGATCCTACCTATATAACTT
TTGGATCTGTTTTATGTGTTCAGGAAAATGCTGAAGTGACCCCTTACTGTATAACAATAC
TATTTATAGCTTCCGTTCCGACTGCCTTAACCACAACCGGCAAGCAAATCCATTGCCCTT
GTCCATACACGTGGTTTCCACCCTAAACTTGCCCCGTTGTACCCTCTTACCGCCCCCCGC
TATTCAACACATCCCTCCCTTGTTAATCGTAATGTGTCCCCCGCCTCCCCAACAGTCGTG
TTCCGTCATTTTCGCACTTTCCCCATTTCCTCTTCC
GenBank Accession AL758942 [GenBank]
Graphic View Graphic view of gene At1g56570
Predicted Position of Insertion Chr1:21196344 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F25P12
Hit Gene Code At1g56570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

 
Line 164A09 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37