SimpleSearch - Line and FST details


Line specific information

 
Line ID 188A05
Vector Used pAC161
Line Availability available as T3 set from NASC (N417957)
Segregation Analysis 50:43:35
Confirmed for Hit At2g46800
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At4g02660

 
Sequence (A. th genome BLAST matches underlined) 
>33-K014624-022-188-A05-8409
CTATGGGATACTACCTGTAAGCGAGTTTCCATGTCAAATCGCTAACCCTATGGGATCCTC
CCTATAGTGAG
GenBank Accession FR805371 [GenBank]
Graphic View Graphic view of gene At4g02660
Predicted Position of Insertion Chr4:1167753 - go to primer design
BLAST e Value 1e-04
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Beige/BEACH and WD40 domain-containing protein
Insertion Classification CDSi
Confirmation Status failed

 
Line 188A05 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37