SimpleSearch - Line and FST details


Line specific information

 
Line ID 202B04
Vector Used pAC161
Line Availability available as unconfirmed T2 stock from NASC (N2108527)
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g65920

 
Sequence (A. th genome BLAST matches underlined) 
>202B04-LB-5-26364892-R-150-a
CCACCAACCTTCCAATCAATCTAGCACAATTGATCTTAGTTTCAATCGAACCATCATTCA
ACATATCAACCATCAACGAGACCCTAGCTGGTTGCATCAATCCAGCTTTGGAATCAGAGT
CAAGCTCAAGATTAACAAGAATAGCTATAG
GenBank Accession KG782744 [GenBank]
Graphic View Graphic view of gene At5g65920
Predicted Position of Insertion Chr5:26364892 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) K14B20
Hit Gene Code At5g65920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit KG782744 [GenBank]


Last Updated on 10.06.2021 13:37