SimpleSearch - Line and FST details


Line specific information

 
Line ID 250H01
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15L12

 
Sequence (A. th genome BLAST matches underlined)
>250H01-LB-5-24277338-R-150-a
AGTTCACGAAAAATATATAGTTCAACATTACTTAGAAGTTAGAAGATTAAATTTTCTTCA
TATAATAATGATCGGAAAGTTGTTCCAATATTAATAGAATATAATATCGTTTCCAGAACA
CATATTTTTGTTCTGATAATAAGTAATAAA
GenBank Accession KG783216 [GenBank]
Graphic View Graphic view of sequence KG783216 of line 250H01
Predicted Position of Insertion Chr5:24277338 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F15L12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 10.06.2021 13:37