SimpleSearch - Line and FST details


Line specific information

 
Line ID 261C02
Vector Used pAC161
Line Availability scheduled for transfer to NASC
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01010

 
Sequence (A. th genome BLAST matches underlined)
>11-K014925-022-261-C02-8409
TTACATGGGCTCCTCTAATATCACAGAGCCTTTAGCTAAGTAAAGAGTCATATGGCTATG
GGATCCTCCCTATAGAGAGAGCATAAAAGCGAATGCGAGTGGAAAAAGGCTGAATACTCT
GTCACGAAACCTCCATAGACCAACACGGTGAACCTGAGCTG
GenBank Accession AL941833 [GenBank]
Graphic View Graphic view of gene At1g01010
Predicted Position of Insertion Chr1:5246 - go to primer design
BLAST e Value 7e-12
Hit Clone Code (BAC ID) T25K16
Hit Gene Code At1g01010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37