SimpleSearch - Line and FST details


Line specific information

 
Line ID 281H05
Vector Used pAC161
Line Availability donated as individual T3 stock by SALK (N922937), homozygous for At4g02710 (Chr4:1193832), TDNA-Seq FST GenBank-ID: KG783511
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02710

 
Sequence (A. th genome BLAST matches underlined) 
>281H05-LB-4-1193832-R-150-a
TTCTCTATTGCTTCCTCTCCTTCTTCAAGCTGTCCTTTGATCGTTTTATACTCGTTTTCT
CCTACTTTCGTCTTTTCCTTCTCCACTGTTTCGACTTTGCTTTTCAAATCTTCTACAGTG
ATCTGAAGATTCTCCAGCTTCTGTAAATCC
GenBank Accession KG783511 [GenBank]
Graphic View Graphic view of gene At4g02710
Predicted Position of Insertion Chr4:1193832 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Kinase interacting (KIP1-like) family protein
Insertion Classification CDSi
Confirmation Status unknown

 
Line 281H05 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37