SimpleSearch - Line and FST details


Line specific information

 
Line ID 435C04
Vector Used pAC161
Line Availability donated as individual T3 stock by SALK (N922998), homozygous for At1g65365 (Chr1:24283497), TDNA-Seq FST GenBank-ID: KG785595
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none
Note

Gene hit At4g02670

 
Sequence (A. th genome BLAST matches underlined)
>27-K018190-022-435-C04-8409
AAAGATCCAAACTTGTGGTTTCTATCTAATCTCTTAAAATAAGGAACTGCAAGTACCTAT
AGGGATCCTCCCTATAGTGAGATACTAAAAAATTAAACAAATTAAACCTCATTTAGGAAA
ACTTGATTTACTACGCGGCTACATTTTCGGTAATAATGTAAATGCACACATCCTTATTAT
AATGACGATCTCCACAACATCCCCCCAATTAATAAATAGAT
GenBank Accession BX290310 [GenBank]
Graphic View Graphic view of gene At4g02670
Predicted Position of Insertion Chr4:1178522 - go to primer design
BLAST e Value 5e-13
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation indeterminate(ID)-domain 12
Insertion Classification 5' region
Confirmation Status failed

 
Line 435C04 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37