SimpleSearch - Line and FST details


Line specific information

 
Line ID 548B08
Vector Used pAC161
Line Availability available as T3 set from NASC (N452532)
Segregation Analysis 50:7:4
Confirmed for Hit At5g05520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g05520

 
Sequence (A. th genome BLAST matches underlined) 
>58-K020587-022-548-B08-8409
GAGAGCGAGCCGATAGTGAGTGACTCTCAATTGCTTTGCTCCTTCTCATGGAGAATCCGG
CGGAGAAACCCGACCCAAATCCATCAAAACCCAAAATCGAATCTGAAGATGAAAGAGAAG
AGCTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNN
GenBank Accession BX547794 [GenBank]
Graphic View Graphic view of gene At5g05520
Predicted Position of Insertion Chr5:1632848 - go to primer design
BLAST e Value 2e-45
Hit Clone Code (BAC ID) MOP10
Hit Gene Code At5g05520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Outer membrane OMP85 family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37