SimpleSearch - Line and FST details


Line specific information

 
Line ID 548H05
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g01445

 
Sequence (A. th genome BLAST matches underlined) 
>40-K020632-022-548-H05-8409
TGCCATGTCCTTAGAAGATTTGGTAAGGCAGAACATTTGTACATTTTATTCCTGTTATCA
AGGAGAGAAATGCCTATGGGATCCTCCCTATAGTGAGACCCA
GenBank Accession BX547847 [GenBank]
Graphic View Graphic view of gene At5g01445
Predicted Position of Insertion Chr5:182807 - go to primer design
BLAST e Value 1e-30
Hit Clone Code (BAC ID) T10O8
Hit Gene Code At5g01445 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 10.06.2021 13:37