SimpleSearch - Line and FST details
Line specific information
Line ID | 549C05 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N452637) |
Segregation Analysis | 50:39:25 |
Confirmed for Hit | At3g13724 |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At3g13724
Sequence (A. th genome BLAST matches underlined) | >35-K020633-022-549-C05-8409 TAATGAGTATATCACCATTTAGTCCTATGGGATCCTCCCTATAGTGAG |
GenBank Accession | FR812045 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr3:4496874 - go to primer design |
BLAST e Value | 8e-04 |
Hit Clone Code (BAC ID) | MMM17 |
Hit Gene Code | At3g13724 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | miRNA |
Insertion Classification | TS2TE |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | FR812045 [GenBank] |
Last Updated on 10.06.2021 13:37 |