SimpleSearch - Line and FST details


Line specific information

 
Line ID 561H09
Vector Used pAC161
Line Availability available as T3 set from NASC (N453853)
Segregation Analysis 50:21:11
Confirmed for Hit At1g06950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g06950

 
Sequence (A. th genome BLAST matches underlined)
>72-K021663-022-561-H09-8409
TTGTTTAATGGAAGTTTCATTTTGGCAACTCACTCCTTCTTGGTAATCTGAAGTTCTGTG
CTAATGTCTTGACCTCATTTCTATGGGATCCTCCCTATAGTGAGACNNACTAC
GenBank Accession BX651601 [GenBank]
Graphic View Graphic view of gene At1g06950
Predicted Position of Insertion Chr1:2134326 - go to primer design
BLAST e Value 3e-37
Hit Clone Code (BAC ID) F4H5
Hit Gene Code At1g06950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocon at the inner envelope membrane of chloroplasts 110
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37