SimpleSearch - Line and FST details


Line specific information

 
Line ID 589D08
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g02550

 
Sequence (A. th genome BLAST matches underlined)
>60-K021428-022-589-D08-8409
GATCCCGATTATTTACTATACGTATGGGATCCTCCCTCTTCTGAGACTCTGGGTTTCTCG
GGAAACAAGTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX655460 [GenBank]
Graphic View Graphic view of gene At4g02550
Predicted Position of Insertion Chr4:1122154 - go to primer design
BLAST e Value 4e-06
Hit Clone Code (BAC ID) T10P11
Hit Gene Code At4g02550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Myb/SANT-like DNA-binding domain protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

 
Line 589D08 has other hits detected, show all hits of this line


Last Updated on 10.06.2021 13:37