SimpleSearch - Line and FST details


Line specific information

 
Line ID 682C07
Vector Used pAC161
Line Availability available as T3 set from NASC (N465407)
Segregation Analysis 50:48:45
Confirmed for Hit At5g37800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g37800

 
Sequence (A. th genome BLAST matches underlined) 
>51-K023110-022-682-C07-8409
GAAGCCATTACAATTGAATATATCCCGGGAAACATAACTACACAAACATTGGTCTCCTCT
TTGCTTACCAATCTACAATCCTAAAACCAATTTTTCGTAGCCCCCACCCCCCCACACCCC
AAAGAAACAGCGAAAGGAAGCAGAAAGAAACCACAAACCAACAC
GenBank Accession BX661977 [GenBank]
Graphic View Graphic view of gene At5g37800
Predicted Position of Insertion Chr5:15036036 - go to primer design
BLAST e Value 7e-14
Hit Clone Code (BAC ID) K22F20
Hit Gene Code At5g37800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RHD SIX-LIKE 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX894721 [GenBank] BX661977 [GenBank]


Last Updated on 10.06.2021 13:37