SimpleSearch - Line and FST details


Line specific information

 
Line ID 684A10
Vector Used pAC161
Line Availability available as T3 set from NASC (N465578)
Segregation Analysis 50:49:42
Confirmed for Hit At1g19240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g19240

 
Sequence (A. th genome BLAST matches underlined) 
>73-K023047-022-684-A10-8409
AGCAATCGCTTCCTTTCATGACTGGAATCACTCATTGAACCCTAAACCCTAATTGATCGG
CCAGAAATGGAGGGTTTGGA
GenBank Accession BX662067 [GenBank]
Graphic View Graphic view of gene At1g19240
Predicted Position of Insertion Chr1:6650448 - go to primer design
BLAST e Value 3e-28
Hit Clone Code (BAC ID) T29M8
Hit Gene Code At1g19240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX662067 [GenBank]


Last Updated on 10.06.2021 13:37