SimpleSearch - Line and FST details
Line specific information
| Line ID | 685G03 |
| Vector Used | pAC161 |
| Line Availability | not available |
| Segregation Analysis | unknown |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At4g31700
| Sequence (A. th genome BLAST matches underlined) | >23-K024533-022-685-G03-8409 CCTTAGGCTTGTGACCCCCTTGACTCCTCCGAGGAAGAGAGCTATGGGATCCTCCC |
| GenBank Accession | BX943622 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:15346617 - go to primer design |
| BLAST e Value | 1e-06 |
| Hit Clone Code (BAC ID) | F28M20 |
| Hit Gene Code | At4g31700 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | ribosomal protein S6 |
| Insertion Classification | CDSi |
| Confirmation Status | unknown |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
