SimpleSearch - Line and FST details


Line specific information

 
Line ID 687H08
Vector Used pAC161
Line Availability available as T3 set from NASC (N465948)
Segregation Analysis 50:40:29
Confirmed for Hit At3g47180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g47180

 
Sequence (A. th genome BLAST matches underlined) 
>64-K022967-022-687-H08-8409
GTGTATAACCAAATGGCGTTGAGACAAAGAAGATTTGTCCCATTTGTTGTTCTGAACCAT
CTGTCAGTTGAAATGTAATGGGATCCTCCCCCCCCC
GenBank Accession BX662315 [GenBank]
Graphic View Graphic view of gene At3g47180
Predicted Position of Insertion Chr3:17372937 - go to primer design
BLAST e Value 1e-33
Hit Clone Code (BAC ID) F13I12
Hit Gene Code At3g47180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37