SimpleSearch - Line and FST details


Line specific information

 
Line ID 837A12
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g06330

 
Sequence (A. th genome BLAST matches underlined)
>89-K025717-022-837-A12-8409
TACTACACCGATGTTTTCTCTTTCGCGTATCATCATCTTGCTCCGGAAAAACACGTAGGG
GTGGGTACGGGATCCTCCCTATAGTGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
GenBank Accession CR400584 [GenBank]
Graphic View Graphic view of gene At3g06330
Predicted Position of Insertion Chr3:1919947 - go to primer design
BLAST e Value 6e-14
Hit Clone Code (BAC ID) F28L1
Hit Gene Code At3g06330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 10.06.2021 13:37