SimpleSearch - Line and FST details
Line specific information
| Line ID | 974H10 |
| Vector Used | pAC161 |
| Line Availability | not available |
| Segregation Analysis | unknown |
| Parent of DUPLO pair | none |
| Parent of pair(s) | none |
Gene hit At5g67420
| Sequence (A. th genome BLAST matches underlined) | >80-K104957-0022-974-H10-8409 ACTCATCCATATGTGCTTCCATTTTTGGTGAAAAACATACATCTATGGAATCCGCCCTAT ATTGAG |
| GenBank Accession | FR819654 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:26906170 - go to primer design |
| BLAST e Value | 3e-06 |
| Hit Clone Code (BAC ID) | K8K14 |
| Hit Gene Code | At5g67420 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | LOB domain-containing protein 37 |
| Insertion Classification | TS2TE (5') |
| Confirmation Status | unknown |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
