SimpleSearch - Line and FST details


Line specific information

 
Line ID 974H10
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g67420

 
Sequence (A. th genome BLAST matches underlined)
>80-K104957-0022-974-H10-8409
ACTCATCCATATGTGCTTCCATTTTTGGTGAAAAACATACATCTATGGAATCCGCCCTAT
ATTGAG
GenBank Accession FR819654 [GenBank]
Graphic View Graphic view of gene At5g67420
Predicted Position of Insertion Chr5:26906170 - go to primer design
BLAST e Value 3e-06
Hit Clone Code (BAC ID) K8K14
Hit Gene Code At5g67420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 37
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 10.06.2021 13:37