SimpleSearch - Line and FST details
Line specific information
Line ID | 974H10 |
Vector Used | pAC161 |
Line Availability | not available |
Segregation Analysis | unknown |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At5g67420
Sequence (A. th genome BLAST matches underlined) | >80-K104957-0022-974-H10-8409 ACTCATCCATATGTGCTTCCATTTTTGGTGAAAAACATACATCTATGGAATCCGCCCTAT ATTGAG |
GenBank Accession | FR819654 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr5:26906170 - go to primer design |
BLAST e Value | 3e-06 |
Hit Clone Code (BAC ID) | K8K14 |
Hit Gene Code | At5g67420 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | LOB domain-containing protein 37 |
Insertion Classification | TS2TE (5') |
Confirmation Status | unknown |
Last Updated on 10.06.2021 13:37 |