SimpleSearch - Line and FST details


Line specific information

 
Line ID 016F07
Vector Used pAC106
Line Availability available as T3 set from NASC (N401507)
Segregation Analysis 50:49:33
Confirmed for Hit At1g28690
Parent of DUPLO pair none
Parent of pair(s) 61670, 93851

Gene hit At1g28690

 
Sequence (A. th genome BLAST matches underlined) 
>54-K012439-022-016-F07-8409
CGACCGACTTATCTCTCTCTGGTCTTTGATCTTGGAAGATGGAAACAGAACCTCTGTAGA
TTACACGAAAAGGTTCAATCTTTATTCACACAATT
GenBank Accession FR800465 [GenBank]
Graphic View Graphic view of gene At1g28690
Predicted Position of Insertion Chr1:10082079 - go to primer design
BLAST e Value 3e-10
Hit Clone Code (BAC ID) F1K23
Hit Gene Code At1g28690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-diphospho-sugar transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37