SimpleSearch - Line and FST details


Line specific information

 
Line ID 025A02
Vector Used pAC106
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair 11764
Parent of pair(s) none
Note

Gene hit At5g65820

 
Sequence (A. th genome BLAST matches underlined)
>09-K013757-022-025-A02-8409
GTGATCCATGTAGATTTCCCTGACATGAAGCCCTTTACACTTGAATATTCAATTTTCGGG
CAACCAATCCCGTTACTTCTCCGGAATTATCTTCGAGAGCCCTATAGAATCCTCCCTATA
GTGAG
GenBank Accession AL762474 [GenBank]
Graphic View Graphic view of gene At5g65820
Predicted Position of Insertion Chr5:26341609 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) MPA24
Hit Gene Code At5g65820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status failed
Other FSTs Supporting this Hit AL762474 [GenBank]


Last Updated on 10.06.2021 13:37