SimpleSearch - Line and FST details


Line specific information

 
Line ID 025G04
Vector Used pAC106
Line Availability available as T3 set from NASC (N402380)
Segregation Analysis 50:40:23
Confirmed for Hit At1g44020
Parent of DUPLO pair none
Parent of pair(s) 12576

Gene hit At1g44020

 
Sequence (A. th genome BLAST matches underlined) 
>31-K013722-022-025-G04-8409
TCTTTTCGGCTCCGAATCGGTATAATCAATGATAAAAATTATTTGAGCAATGAGTGTATA
CAGCTCTGAATCTCGATCCAAATAGTAGAGAAGAGAAAACGTGTGTGTAAAGAGTGCCGC
TATGGGATCCTCCCTATAGTGAGACNAAAAAANNCCCTTTTCCCNCCTNTACCCCCTCCC
ATTAATTTGCCCAACCCCCCCCCGGTTTCTCCCCCCAAATCTCAAACCTTT
GenBank Accession AL762545 [GenBank]
Graphic View Graphic view of gene At1g44020
Predicted Position of Insertion Chr1:16717679 - go to primer design
BLAST e Value 1e-56
Hit Clone Code (BAC ID) F9C16
Hit Gene Code At1g44020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine/Histidine-rich C1 domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL762545 [GenBank]


Last Updated on 10.06.2021 13:37