SimpleSearch - Line and FST details


Line specific information

 
Line ID 034E04
Vector Used pAC161
Line Availability available as T3 set from NASC (N403220)
available as unconfirmed T2 stock from NASC (N2108063)
Segregation Analysis 50:38:24
Confirmed for Hit At2g37180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g37180

 
Sequence (A. th genome BLAST matches underlined)
>034E04-LB-2-15617782-R-150-a
GCTAAAGACGTGGAAGGACCTGATGGATTTCAGACGAGAGATTACGAAGATCCTCCGCCA
ACACCGTTTTTCGACGCAGAGGAGCTTACCAAGTGGTCTTTATACAGAGCAGTCATCGCC
GAGTTCGTAGCCACTCTCCTCTTCTTGTAC
GenBank Accession KG780295 [GenBank]
Graphic View Graphic view of gene At2g37180
Predicted Position of Insertion Chr2:15617782 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T2N18
Hit Gene Code At2g37180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Aquaporin-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG780295 [GenBank]


Last Updated on 10.06.2021 13:37