SimpleSearch - Line and FST details


Line specific information

 
Line ID 094E02
Vector Used pAC161
Line Availability available as T3 set from NASC (N408978)
available as unconfirmed T2 stock from NASC (N2108227)
Segregation Analysis 50:36:36
Confirmed for Hit At2g35650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g35650

 
Sequence (A. th genome BLAST matches underlined) 
>094E02-LB-2-14985679-R-150-a
CTCCTCTCACTGGTTCGTTCCCTCCATTGACGAATGTTGCATTTTGCTTGTTACCTACGA
CTGCTTTTGATTCTCTTTCTCCATTTGGGTTTCTTCCGATTACTTTAATACTTCTTCAAT
TTGGACTTGTCGTCAACATTTTCTTGCTAA
GenBank Accession KG781178 [GenBank]
Graphic View Graphic view of gene At2g35650
Predicted Position of Insertion Chr2:14985679 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) T20F21
Hit Gene Code At2g35650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cellulose synthase like
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG781178 [GenBank]


Last Updated on 10.06.2021 13:37