SimpleSearch - Line and FST details


Line specific information

 
Line ID 122B02
Vector Used pAC161
Line Availability available as T3 set from NASC (N411630)
Segregation Analysis 50:47:30
Confirmed for Hit At2g34660
Parent of DUPLO pair none
Parent of pair(s) 2331, 95619, 95621

Gene hit At2g34660

 
Sequence (A. th genome BLAST matches underlined) 
>10-K028831-022-122-B02-8409
ACTATACCTTTGCGGGATATCAGAATGACTTTTCCAGGCTTTCAATGTTTTCAGGTATGG
CATCCTCCCTATAGTGAGTCGAATTACGCACTCCCCTTTACAGTGGCGCGTACTACCCGC
GCTGTTTACCTCTTCC
GenBank Accession CR934606 [GenBank]
Graphic View Graphic view of gene At2g34660
Predicted Position of Insertion Chr2:14609492 - go to primer design
BLAST e Value 5e-24
Hit Clone Code (BAC ID) T29F13
Hit Gene Code At2g34660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation multidrug resistance-associated protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770136 [GenBank] CR934605 [GenBank] CR934605 [GenBank]


Last Updated on 10.06.2021 13:37