SimpleSearch - Line and FST details


Line specific information

 
Line ID 173H06
Vector Used pAC161
Line Availability available as T3 set from NASC (N416602)
Segregation Analysis 50:42:39
Confirmed for Hit At2g31960
Parent of DUPLO pair none
Parent of pair(s) 5456, 5477, 5479, 5482, 5574, 5581, 10396, 92356, 92367

Gene hit At2g31960

 
Sequence (A. th genome BLAST matches underlined) 
>48-K013459-022-173-H06-8409
ATGAAGCCCTTTACACCTGAATATATCCATCATACTCATGCATGCATTTACTGCAAGAGT
TGTTTCATTCTCCTGCAGAAGTTTGGGATATAAGGCAAAATGACACATAATCCCCTATGG
GATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession AL770688 [GenBank]
Graphic View Graphic view of gene At2g31960
Predicted Position of Insertion Chr2:13590069 - go to primer design
BLAST e Value 9e-30
Hit Clone Code (BAC ID) F22D22
Hit Gene Code At2g31960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glucan synthase-like 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770688 [GenBank]


Last Updated on 10.06.2021 13:37