SimpleSearch - Line and FST details


Line specific information

 
Line ID 200G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N419188)
Segregation Analysis 50:24:23
Confirmed for Hit At5g60910
Parent of DUPLO pair none
Parent of pair(s) 3713, 3821, 92652

Gene hit At5g60910

 
Sequence (A. th genome BLAST matches underlined) 
>95-K028833-022-200-G12-8409
AATATCCTGAAAATAGCATAAAATTATGAAACTTAGTATGGGATCCTCCCTATAGTGAGT
CCTATTACTCAT
GenBank Accession CR934938 [GenBank]
Graphic View Graphic view of gene At5g60910
Predicted Position of Insertion Chr5:24505542 - go to primer design
BLAST e Value 3e-09
Hit Clone Code (BAC ID) MSL3
Hit Gene Code At5g60910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR934938 [GenBank]


Last Updated on 10.06.2021 13:37