SimpleSearch - Line and FST details


Line specific information

 
Line ID 212D10
Vector Used pAC161
Line Availability available as T3 set from NASC (N420302)
Segregation Analysis 50:27:19
Confirmed for Hit At5g44380
Parent of DUPLO pair none
Parent of pair(s) 6559, 6583, 6595, 10691, 11432, 82453, 82474, 82490, 82511, 82528, 82545, 82563, 82578, 82595, 82608, 82632, 82633, 82634, 82635, 82636, 82637, 82638, 82639, 82640, 82641

Gene hit At5g44380

 
Sequence (A. th genome BLAST matches underlined)
>76-K014133-022-212-D10-8409
ATTGCCGTTCTTTATATTTGTATGAAAAATTATATAAACAATCATATTTGTGATATATTT
AATACTTTCTATAGCATCCTCCCTATAGTGAGACTGAC
GenBank Accession AL766631 [GenBank]
Graphic View Graphic view of gene At5g44380
Predicted Position of Insertion Chr5:17880844 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) K9L2
Hit Gene Code At5g44380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD-binding Berberine family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37