SimpleSearch - Line and FST details


Line specific information

 
Line ID 213D09
Vector Used pAC161
Line Availability available as T3 set from NASC (N420397)
Segregation Analysis 50:49:36
Confirmed for Hit At4g33430
Parent of DUPLO pair none
Parent of pair(s) 6064, 6118, 6140, 6166, 86091, 86104, 86109

Gene hit At4g33430

 
Sequence (A. th genome BLAST matches underlined) 
>68-K014134-022-213-D09-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAATACATGGCTTCAATT
GAATATTTCCCGGACTGAGCAAAAATGAAGTTCAAGTAAATTCTCAGTAGATGCGAAAAT
CCGAATCATCTTGGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL766744 [GenBank]
Graphic View Graphic view of gene At4g33430
Predicted Position of Insertion Chr4:16089704 - go to primer design
BLAST e Value 6e-28
Hit Clone Code (BAC ID) F17M5
Hit Gene Code At4g33430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BRI1-associated receptor kinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766745 [GenBank]


Last Updated on 10.06.2021 13:37