SimpleSearch - Line and FST details


Line specific information

 
Line ID 216E07
Vector Used pAC161
Line Availability available as T3 set from NASC (N420695)
Segregation Analysis 50:20:9
Confirmed for Hit At2g02560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g02560

 
Sequence (A. th genome BLAST matches underlined) 
>53-K014145-022-216-E07-8409
TTGATCCATGTAGATTNTCCCGGACATGAAGCACTTGACACTCTCCTCCATCTTTTTTTA
CTTTCCTCAGAGCTCTCTCCTCTCCGCAACTTCCACCACCACCAAATCGGAACTCTCGGC
GTTCTACTCCGTCTCCGGCGTTACCTCCGTCGATTTCATCTTCTCAGGTTACTTAGGGTT
ACCTCTTTTTTGCTTTTTGATCGATAAAGTGTGATGATGCCTATGGGATCCT
GenBank Accession AL767112 [GenBank]
Graphic View Graphic view of gene At2g02560
Predicted Position of Insertion Chr2:689827 - go to primer design
BLAST e Value 5e-65
Hit Clone Code (BAC ID) T8K22
Hit Gene Code At2g02560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cullin-associated and neddylation dissociated
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL767111 [GenBank]


Last Updated on 10.06.2021 13:37