SimpleSearch - Line and FST details


Line specific information

 
Line ID 228C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N421825)
Segregation Analysis 50:17:8
Confirmed for Hit At1g29690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g29690

 
Sequence (A. th genome BLAST matches underlined) 
>228C09-LB-1-10379667-R-150-a
GAGATCGCCGATGTGGGTCTCTGTGTGTTCGATAGGTGAGGTGCTTACGTGAGAGAAGTT
CTTCCATTTGATTGGCTCGAACCAGCGGCTATCTTGCTCCTCTGGTCCTTGCCATTTCGG
TGCACCTATTGGCACGTGAGAGTCCCAATG
GenBank Accession KG782991 [GenBank]
Graphic View Graphic view of gene At1g29690
Predicted Position of Insertion Chr1:10379667 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F15D2
Hit Gene Code At1g29690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAC/Perforin domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG782991 [GenBank] KG782991 [GenBank]


Last Updated on 10.06.2021 13:37