SimpleSearch - Line and FST details


Line specific information

 
Line ID 264G05
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair 12030
Parent of pair(s) none
Note

Gene hit At5g27630

 
Sequence (A. th genome BLAST matches underlined)
>39-K014997-022-264-G05-8409
AAATCCAGAGCCTGCATTTGAAACACCATCTCCAGAAAACATGCTACTCAATAGTCACGA
CAAGCGCCCCACACCCACATACCTGCCACAAGGCCCTAGAACGCACGCACAAGTGACCCC
CATTATTTCCCTCCCACCCCCCCCCGCT
GenBank Accession FR806804 [GenBank]
Graphic View Graphic view of gene At5g27630
Predicted Position of Insertion Chr5:9777994 - go to primer design
BLAST e Value 9e-05
Hit Clone Code (BAC ID) F15A18
Hit Gene Code At5g27630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acyl-CoA binding protein 5
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 10.06.2021 13:37