SimpleSearch - Line and FST details


Line specific information

 
Line ID 268D08
Vector Used pAC161
Line Availability available as T3 set from NASC (N425676)
Segregation Analysis 50:39:27
Confirmed for Hit At4g30950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g30950

 
Sequence (A. th genome BLAST matches underlined) 
>60-K015061-022-268-D08-8409
CTGATCCATGTAGATTATCCCGGACCATGAAGCCTTTACAATTGAATATATCCTGTAGAT
GAGCACATTCACAATGGTTCATCATACGGCTCCGCATATACCTTTCAAGCCTGCGGATGA
GTGGAACGCGGCTCAGGCCCAGCTGAATGGAACTGTTCATTGTGACTACCCTAGGTGCTG
C
GenBank Accession AL942701 [GenBank]
Graphic View Graphic view of gene At4g30950
Predicted Position of Insertion Chr4:15057906 - go to primer design
BLAST e Value 8e-61
Hit Clone Code (BAC ID) F6I18
Hit Gene Code At4g30950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation fatty acid desaturase 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37