SimpleSearch - Line and FST details


Line specific information

 
Line ID 354D01
Vector Used pAC161
Line Availability available as T3 set from NASC (N433925)
Segregation Analysis 50:49:45
Confirmed for Hit At4g20910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g20910

 
Sequence (A. th genome BLAST matches underlined) 
>04-K016365w-022-354-D01-8409
AAGGATCTTGTAAACATAAAGGTCGATTTTATGGCTAATCTGCAAAAGTCATGGCAAAAG
AACTAAACGAGCTTTGAGTTTTATAGATGAACACGTCATCACATTGCTTGCACTATATAT
ATTCTCTGGTAGATACTACCCTATG
GenBank Accession AL953762 [GenBank]
Graphic View Graphic view of gene At4g20910
Predicted Position of Insertion Chr4:11186118 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) T13K14
Hit Gene Code At4g20910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation double-stranded RNA binding protein-related / DsRBD protein-like protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL953762 [GenBank] AL953762 [GenBank]


Last Updated on 10.06.2021 13:37