SimpleSearch - Line and FST details


Line specific information

 
Line ID 374F09
Vector Used pAC161
Line Availability available as T3 set from NASC (N435877)
Segregation Analysis 50:45:45
Confirmed for Hit At1g68600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g68600

 
Sequence (A. th genome BLAST matches underlined) 
>70-K017166-022-374-F09-8409
TCTATATATTTCTTTTTCTTTTTCTTTCTTTTGGATTAGACATTTTTTCCCCCGGTTATT
CAATTCATGTGCCATCATCTTTTTTTTTCTCCACAAGATATGGGATCCTCCCTATAGTGA
G
GenBank Accession BX003759 [GenBank]
Graphic View Graphic view of gene At1g68600
Predicted Position of Insertion Chr1:25761904 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) F24J5
Hit Gene Code At1g68600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aluminum activated malate transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003759 [GenBank]


Last Updated on 10.06.2021 13:37