SimpleSearch - Line and FST details


Line specific information

 
Line ID 408H11
Vector Used pAC161
Line Availability available as T3 set from NASC (N439167)
Segregation Analysis 50:36:27
Confirmed for Hit At1g69600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g69600

 
Sequence (A. th genome BLAST matches underlined) 
>408H11-LB-1-26182802-R-150-a
TCCTGTTCCTTGCTCTTACTACACCTCAGCTCCTCCACATCACGTGATTCTCTCTCTCAG
CTCCGGTTTCCCTGGACCGTCAGATCAAGATCCAACGGTGGTTAGGTCAGAGAACAGTTC
AAGAGGAGCAATGAGGAAACGAACAAGAAC
GenBank Accession KG785000 [GenBank]
Graphic View Graphic view of gene At1g69600
Predicted Position of Insertion Chr1:26182802 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F24J1
Hit Gene Code At1g69600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger homeodomain 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit KG785000 [GenBank]


Last Updated on 10.06.2021 13:37