SimpleSearch - Line and FST details


Line specific information

 
Line ID 414B02
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) 6823

Gene hit At4g26890

 
Sequence (A. th genome BLAST matches underlined) 
>414B02-LB-4-13513454-F-150-a
TACATAGATTCTTTTATTTTGAAGTTTGAACACATGGACATTGTTTCATCAGACTTGGTT
AGTGAATTTAACATGAGCTTGCAATTTGAAAAACAAATGTTTGTTATTAGTACGAAACAT
ATTCTTTATGGATACATTTTCATCTTCATC
GenBank Accession KG785159 [GenBank]
Graphic View Graphic view of gene At4g26890
Predicted Position of Insertion Chr4:13513454 - go to primer design
BLAST e Value 3e-80
Hit Clone Code (BAC ID) F10M23
Hit Gene Code At4g26890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 16
Insertion Classification 3' region
Confirmation Status unknown


Last Updated on 10.06.2021 13:37