SimpleSearch - Line and FST details
Line specific information
| Line ID | 427F01 |
| Vector Used | pAC161 |
| Line Availability | not available |
| Segregation Analysis | unknown |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 10090 |
| Note |
Gene hit At4g11850
| Sequence (A. th genome BLAST matches underlined) | >06-K018076-022-427-F01-8409 AGGTCGGAAGAAAGTGGAAGGTGAAAATTCTTCTAAGATCACTATGGGATCCTCCCAATA G |
| GenBank Accession | BX289533 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:7132900 - go to primer design |
| BLAST e Value | 3e-11 |
| Hit Clone Code (BAC ID) | T26M18 |
| Hit Gene Code | At4g11850 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | phospholipase D gamma 1 |
| Insertion Classification | CDSi |
| Confirmation Status | failed |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
