SimpleSearch - Line and FST details
Line specific information
Line ID | 427F01 |
Vector Used | pAC161 |
Line Availability | not available |
Segregation Analysis | unknown |
Parent of DUPLO pair | none |
Parent of pair(s) | 10090 |
Note |
Gene hit At4g11850
Sequence (A. th genome BLAST matches underlined) | >06-K018076-022-427-F01-8409 AGGTCGGAAGAAAGTGGAAGGTGAAAATTCTTCTAAGATCACTATGGGATCCTCCCAATA G |
GenBank Accession | BX289533 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr4:7132900 - go to primer design |
BLAST e Value | 3e-11 |
Hit Clone Code (BAC ID) | T26M18 |
Hit Gene Code | At4g11850 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | phospholipase D gamma 1 |
Insertion Classification | CDSi |
Confirmation Status | failed |
Last Updated on 10.06.2021 13:37 |