SimpleSearch - Line and FST details


Line specific information

 
Line ID 446H09
Vector Used pAC161
Line Availability available as T3 set from NASC (N442813)
Segregation Analysis 50:40:29
Confirmed for Hit At3g02580
Parent of DUPLO pair none
Parent of pair(s) 11093

Gene hit At3g02580

 
Sequence (A. th genome BLAST matches underlined)
>72-K023729-022-446-H09-8409
CTTGTAGGAAATTGGTAGCATTTAGTTTCCTACCAAAAAAGACTTTGTCAGCAGCTGCTT
GTACTCCAAATCACATTTTGCATTCCTTATCCATAAAGTAACCAGAAAGGCTATGGGATC
CTCCCTATAGTGAGTCCTATTACACGCGGCCCCA
GenBank Accession BX891183 [GenBank]
Graphic View Graphic view of gene At3g02580
Predicted Position of Insertion Chr3:547881 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) F16B3
Hit Gene Code At3g02580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sterol 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891183 [GenBank]


Last Updated on 10.06.2021 13:37