SimpleSearch - Line and FST details


Line specific information

 
Line ID 450E06
Vector Used pAC161
Line Availability available as T3 set from NASC (N443158)
Segregation Analysis 50:46:35
Confirmed for Hit At4g19600
Parent of DUPLO pair 11790
Parent of pair(s) none

Gene hit At4g19600

 
Sequence (A. th genome BLAST matches underlined) 
>45-K019252-022-450-E06-8409
TGATCTGTAGATTTCCGGACTGAAGCCATTTACATTGAATATATCCCGCTTGCACAGGTG
CATGTTATCGGCTCTGAAGATTGACATGACCATCCATCAATGTCTTCCCGTACACTTTCT
CTCGCTCTACTGTCATCTATATTATATAGGTGAAGGGATAAAATCCTGACCTAGATGATC
CCCCCTATATACATGTAGCATTTTCCATTTGATTACTTCTTGCGAGCTTGGTCTATGGGA
TC
GenBank Accession BX292043 [GenBank]
Graphic View Graphic view of gene At4g19600
Predicted Position of Insertion Chr4:10673750 - go to primer design
BLAST e Value 2e-12
Hit Clone Code (BAC ID) F24J7
Hit Gene Code At4g19600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX292043 [GenBank]


Last Updated on 10.06.2021 13:37