SimpleSearch - Line and FST details


Line specific information

 
Line ID 483G04
Vector Used pAC161
Line Availability available as T3 set from NASC (N446348)
Segregation Analysis 60:35:25
Confirmed for Hit At5g20000
Parent of DUPLO pair none
Parent of pair(s) 96282, 96286, 96293

Gene hit At5g20000

 
Sequence (A. th genome BLAST matches underlined) 
>31-K019729-022-483-G04-8409
TTGATGGACAAGAGCATGTCGATTTTTGGTAAGGTGATGGGAATACCAAGGTCTTGGTTA
AGGTATGAATGTTTTTATCGTATTATCTATGGGATCCTCCCTATAGTGAGACTATGGGAT
CCTCCCTATACTGGGGCTATGGGATCCTCCCTATAGTGTGCTACCCTGAATTGATACCCC
CCATTTGGACCTTAATGTAGACACCCC
GenBank Accession BX531776 [GenBank]
Graphic View Graphic view of gene At5g20000
Predicted Position of Insertion Chr5:6757560 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) F28I16
Hit Gene Code At5g20000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AAA-type ATPase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531776 [GenBank]


Last Updated on 10.06.2021 13:37